You must set at least one mode in command line, otherwise no any actions will be done, def_fasta_qua:XX Default quality for input file(s) in FASTA format. You can change this value by -def_fasta_qua: option. phread64 Illumina 1.3+ and Illumina 1.5+ version formatįor FASTA format each nucleotide have fixed quality. phread33 Sanger and Illumina 1.8+ version format You are need to specify FASTQ version by one of this options: fastq input file(s) are in FASTQ format. Input files parameters -fasta input file(s) are in FASTA format.(Default) SE Input file is the "SE" (Single ends) reads. PE Input file(s) is the "PE" reads (default). In this case sequences of paired reads are supposed to be in order (even/odd). Obviously the sequence number of reads from one pair must be equal.Ģ. In this case first read from pair must be placed in one fileĪnd second read in other file. There are two valid variants for "MP" and "PE" reads:ġ. You can specify only one file for single ends reads. adpt2_seq:GGACC.TA Read2 adapter sequence, may be set more than once adpt1_seq:AGATC.GA Read1 adapter sequence, may be set more than once More than one adapter sequences can be use for each set of reads. build folderĪssembled programs are to be placed to the. The adapter_trim main goal is removing adapters from reads, but you can use it for the task of searching and removing polyN tails and cutting sequence by quality. adapter_trim SRR519624_1.fastq SRR519624_2.fastq -ifastq - phread33 -PE -o:adapter_trim.cfg -cut_polyN -cut_qual -cut_qual_level:15 -to_fastq -to_two_filesĪdapter_trim is a newest program for the preparation of short sequences (reads) sets for further analysis. ![]() Result will be saved to two files in FASTQ format. Remove polyN and low quality tails from reads in FASTQ format. ![]() adapter_trim SRR519624_1.fastq SRR519624_2.fastq -ifastq -phread33 -PE -o:adapter_trim.cfg -adapters_trim -adpt1_seq:AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG -adpt2_seq:AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -min_read_flen:0 -min_read_slen:0 -to_one_file -to_fasta -j:7 Result will be saved to one file in FASTA format. Scan FASTQ pair-ends reads and remove adapters. Try to determinate adapters sequences in FASTQ pair-ends reads.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |